BIOO SCIENTIFIC NOVA-5150-01 Cell Free DNA-Seq Kit User Manual
- June 9, 2024
- BIOO SCIENTIFIC
Table of Contents
BIOO SCIENTIFIC NOVA-5150-01 Cell Free DNA-Seq Kit
NEXTFLEX® Cell Free DNA-Seq Kit 2.0 (For Illumina® Platforms)
Catalog #NOVA-5150-01 (Kit contains 8 reactions)
Th is product is for research use only.
Not for use in diagnostic procedures.
Th is manual is proprietary to Bioo Scientific Corp., and intended only for customer use in connection with the product(s) described herein and for no other purpose.
This document and its contents shall not be used or distributed for any other
purpose without the prior written consent of Bioo Scientific.
Follow the protocol included with the kit.
Bioo Scientific, NEXT flex, Next Prep, Next Prep-Mag, AIR, The NGS Experts, QRNA, Amplicon Studio, and Nanoq are trademarks or registered trademarks of Bioo Scientific. All other brands and names contained herein are the property of their respective owners.
GENERAL INFORMATION
Product Overview
Cell free DNA has become a powerful marker in clinical research applications
due to the unique origin of DNA molecules present in plasma or serum.
Detection of fetal DNA from maternal plasma has proven to be a viable, non-
invasive option to identify a variety of fetal traits includ-ing: sex
determination, sex chromosome-linked disorders and aneuploidy events.
Circulating tumor DNA extracted from plasma of symptomatic patients can be
used as a non-invasive re-source for research towards diagnosis, prognosis,
treatment decisions, and follow-up monitor-ing of cancer patients.
The NEXTFLEX® Cell Free DNA-Seq Kit 2.0 is designed for 3 hour DNA library
construction of cell free fetal or circulating tumor DNA. The kit can be used
to prepare single, paired-end and multiplexed DNA libraries for sequencing
using Illumina® platforms. NEXTFLEX® 1-step End-Repair and Adenylation
protocol simplifies workflow and shortens hands-on library con-struction time.
In addition, the availability of up to 384 unique adapter barcodes facilitates
high-throughput applications.
There are three main steps involved in preparing cell free DNA for sequencing:
DNA End Re-pair & Adenylation, Adapter Ligation and PCR Amplification. The
optional Gel-Free Nucleo-some Enchainment step, performed before End Repair &
Adenylation, is designed to enrich for mononom cloesomes or mono-, di-, and
tri-nucleosomes. The NEXTFLEX® Cell Free DNA-Seq Kit 2.0 contains the
necessary material, except barcodes, to take the user’s purified cell free DNA
through library preparation and amplification for loading onto Illumina flow
cells for sequencing. The NEXTFLEX® Cell Free DNA-Sew Kit 2.0 is intended for
research use only.
Revision History
| Version | Date | Description |
|---|---|---|
| V 14.07 | July 2014 | Initial Product Launch |
| V 14.09 | September 2014 | Added Optional Gel-Free Size Selection |
| V 19.02 | February 2019 | Updated product name and optional Gel-Free Size |
Selection to Nucleosome Enrichment protocol. Updated core chemistries for an
improved library prep experience.
V 22.08| August 2022| Manual Update
Contents, Storage and Shelf Life
The NEXTFLEX® Cell Free DNA-Seq Kit 2.0 contains enough material to prepare 8
DNA samples for Illumina® compatible sequencing. The shelf life of all
reagents is at least 6 months when stored properly. The Resuspension Buffer
and Nuclease-free Water can be stored at room temperature. The NEXTFLEX®
caftan Enrichment Beads and Cleanup Beads 2.0 should be stored at 4°C, and all
other components should be stored at -20°C.
| Kit Contents | Amount |
|---|---|
| BROWN CAP | |
| NEXTFLEX® cfDNA Enrichment Beads | 1.5 mL |
| CLEAR CAP | |
| --- | --- |
| NEXTFLEX® End-Repair & Adenylation Buffer Mix 2.0 | 120 µL |
| NEXTFLEX® End-Repair & Adenylation Enzyme Mix 2.0 | 24 µL |
| PURPLE CAP | |
| --- | --- |
| NEXTFLEX® Ligase Buffer Mix 2.0 | 356 µL |
| NEXTFLEX® Ligase Enzyme 2.0 | 24 µL |
| GREEN CAP | |
| --- | --- |
| NEXTFLEX® PCR Master Mix 2.0 | 200 µL |
| NEXTFLEX® Primer Mix 2.0 (50 µM) | 16 µL |
| WHITE CAP | |
| --- | --- |
| Nuclease-free Water | (2) 1.5 mL |
| Resuspension Buffer | 1.5 mL |
| NEXTFLEX® Cleanup Beads 2.0 | 1.5 mL |
Required Materials Not Provided
- 10 ng of cell free DNA in up to 32 µL nuclease-free water. Cell free DNA can be in up to 50 µL nuclease-free water if performing optional size selection step.
- If multiplexing: NEXTFLEX® DNA Barcodes – 6 / 12 / 24 / 48 (Cat # 514101, 514102, 514103, 514104) or NEXTFLEX-96™ DNA Barcodes (Cat # 514106) or NEXTFLEX® Chipset Barcodes – 6 / 12 / 24 / 48 (Cat # 514120, 514121, 514122, 514123) or NEXTFLEX-96™ Chipset Barcodes (Cat # 514124) or NEXTFLEX-HT™ Barcodes (Cat # 514170, 514174, 514175, 514176, 514177) or NEXFLEX® Unique Dual Index Barcodes (Cat # 514150, 514151, 514152, 514153).
- (Optional) NextPrep-Mag™ caftan isolation kits (NOVA-3825 series) may be used to extract caftan from plasma/serum and the NextPrep-Mag™ urine caftan isolation kits (NOVA-3826 series) may be used to extract caftan from urine.
- Ethanol 100% (room temperature)
- Ethanol 80% (room temperature)
- 96 well PCR Plate Non-skirted (Phenix Research, Cat # MPS-499) or similar
- 96 well Library Storage and Pooling Plate (Fisher Scientific, Cat # AB-0765) or similar
- Adhesive PCR Plate Seal (BioRad, Cat # MSB1001)
- Magnetic Stand -96 (Ambion, Cat # AM10027) / or / similar
- Thermal cycler
- 2, 10, 20, 200 and 1000 µL pipettes / multichannel pipettes
- Nuclease-free barrier pipette tips
Warnings and Precautions
We strongly recommend that you read the following warnings and precautions.
Periodically, optimizations and revisions are made to the components and
manual. Therefore, it is important to follow the protocol included with the
kit. If you need further assistance, you may contact your local distributor,
or contact us at ngs@perkinelmer.com.
- Do not use the kit past the expiration date.
- DTT in buffers may precipitate after freezing. If precipitate is seen, vortex buffer for 1-2 minutes or until the precipitate is in solution. The performance of the buffer is not affected once the precipitate is in solution.
- Ensure pipettes are properly calibrated as library preparations are highly sensitive to pi-petting error.
- Do not heat the DNA Adapter above room temperature.
- To enable multiplexing, please use the appropriate combination of DNA Barcodes during the Adapter Ligation step.
- Maintain a laboratory temperature of 20º–25ºC (68º–77ºF).
- Cell free DNA sample quality may vary between preparations. It is highly recommended fluorescent dyes be used as a means for cell free DNA sample quantification, as Nano-Drop cannot accurately detect nucleic acids at concentrations found in pure cell free DNA sample preps (0.05 ng/µL to 1 ng/µL). The user should be aware that contaminating RNA, nucleotides and single-stranded DNA may affect the amount of usable DNA in a sample preparation.
- It is highly recommended that NEXTFLEX® Primer Mix be used during PCR amplifica-tion. Inadvertent use of an incorrect primer sequence can potentially result in elimination of the index.
NEXTFLEX® CELL FREE DNA-SEQ 2.0 SAMPLE PREPARATION PROTOCOL
NEXTFLEX® Cell Free DNA-Seq 2.0 Flow Chart
Figure 1: Sample flow chart with approximate times necessary for each step.
Starting Material
The NEXTFLEX® Cell Free DNA-Seq Kit 2.0 has been optimized and validated using
10 ng cell free DNA.
Reagent Preparation
- Briefly spin down each component to ensure material has not lodged in the cap or side of tube. Keep on ice and vortex each NEXTFLEX® component just prior to use. The Resuspension Buffer and Nuclease-free Water can be stored at room temperature.
- DTT in buffers may precipitate after freezing. If precipitate is seen, vortex buffer for 1- 2 minutes or until the precipitate is in solution. The performance of the buffer is not affected once the precipitate is in solution.
- Allow NEXTFLEX® Enchainment and NEXTFLEX® Cleanup Beads to come to room temperature and vortex the beads until homogenous.
Gel-Free Nucleosome Enrichment (Optional)
This optional size selection step is designed to isolate mono-nucleosomes or
mono-, di-, and tri- nucleosomes. Users who are not interested in enriching
for mono-, di-, and tri- nucleosomes may begin the protocol at Step A: End-
Repair and Adenylation. A minimum 10ng of CFDNA input is required for
enrichment.
Materials
Bioo Scientific Supplied
WHITE CAP – Resuspension Buffer
BROWN CAP – NEXTFLEX® cfDNA Enrichment Beads
User Supplied
Cell free DNA in 50 µL or less Nuclease-free Water
96 well PCR Plate
Adhesive PCR Plate Seal
80% Ethanol, freshly prepared (room temperature)
Magnetic Stand
Desired Enrichment| Mono- nucleosomes Mono-, di-, and tri-
nucleosomes
---|---
Bead Volume #1| 45 30
Bead Volume #2| 60 75
If sample volume is < 50 µL, bring to 50 µL with Nuclease-free Water
- Add Bead Volume #1 to 50 µL cell-free DNA samples as indicated in the corresponding column for your desired enrichment. Mix thoroughly until homogenized by pipetting up and down.
- Incubate sample at room temperature for 5 minutes.
- Place the 96 well PCR plate on the magnetic stand at room temperature for 5 minutes or until the supernatant appears completely clear.
- Do not discard the supernatant in this step. Transfer the clear supernatant to a new well. Be careful not to disrupt the magnetic bead pellet or transfer any magnetic beads with the sample.
- Add Bead Volume #2 to samples as indicated in the corresponding column for your desired enrichment. Mix thoroughly until homogenized by pipetting up and down.
- Incubate sample at room temperature for 5 minutes.
- Place the 96 well PCR Plate on the magnetic stand at room temperature for 5 minutes or until the supernatant appears completely clear.
- Remove and discard the clear supernatant, taking care not to disturb the beads. Some liquid may remain in the wells.
- With the plate on stand, add 200 µL of 80% ethanol to each magnetic bead pellet and incubate plate at room temperature for 30 seconds. Carefully remove the ethanol by pipette.
- Repeat the previous step for a total of 2 ethanol washes. Ensure all ethanol has been removed.
- Remove the 96 well PCR plate from the magnetic stand and let dry at room temperature for 3 minutes.
- Resuspend dried beads with 34 µL Resuspension Buffer. Mix thoroughly until homogenized by pipetting up and down.
- Incubate sample at room temperature for 2 minutes.
- Place the 96 well PCR plate on the magnetic stand at room temperature for 2 minutes or until sample is clear.
- Do not discard the sample (supernatant) in this step. Transfer 32 µL of clear sample to a new well.
- Proceed to Step A: End-Repair and Adenylation.
STEP A: End-Repair & Adenylation
Materials
Bioo Scientific Supplied
CLEAR CAP -NEXTFLEX® End-Repair & Adenylation Buffer Mix 2.0, NEXTFLEX® End-
Repair & Adenylation Enzyme Mix 2.0
WHITE CAP – Nuclease-free Water
User Supplied
- Cell free DNA in 32 µL (or less) nuclease-free water
- Thermal cycler
- 96 well PCR Plate
- Adhesive PCR Plate Seal
- Microcentrifuge
- Ice
- Thaw NEXTFLEX® End-Repair & Adenylation Buffer Mix on ice, and vortex for 5-10 seconds.
- For each sample, combine the following reagents on ice in a nuclease-free 96 well PCR Plate:
- µL Nuclease-free Water
- µL Cell free DNA
- 15 µL NEXTflex® End-Repair & Adenylation Buffer Mix 2.0*
- 3 µL NEXTflex® End-Repair & Adenylation Enzyme Mix 2.0*
- 50 μL TOTAL
-
These components can be premixed and added in a single step. 3. Apply adhesive PCR plate seal and incubate in a thermal cycler using the following program:
30 min 20 °C
30 min 65 °C
end 4 °C- Proceed to Step B: Adapter Ligation.
STEP B: Adapter Ligation
Materials
Bioo Scientific Supplied
PURPLE CAP – NEXTFLEX® Ligase Buffer Mix 2.0, NEXTFLEX® Ligase Enzyme 2.0
WHITE CAP – Nuclease-free Water, Resuspension Buffer, NEXTFLEX® Cleanup
Beads 2.0
User Supplied
- 50 µL of End-Repaired and Adenylated DNA (from Step A)
- Thermal cycler
- Adhesive PCR Plate Seal
- 80% Ethanol, freshly prepared (room temperature)
Magnetic Stand
- NEXTFLEX® Unique Dual Index Barcodes – 96 (Cat # 514150, 514151) or
- NEXTFLEX® Dual Index Barcodes – 96 (Cat # 514160, 514161) or
- NEXTFLEX-HT™ Barcodes – 6 / 96 (Cat # 514170, 514174, 514175, 514176, 514177) or
- NEXTFLEX® DNA Barcodes – 6 / 12 / 24 / 48 (Cat # 514101, 514102, 514103, 514104) or
- NEXTFLEX-96™ DNA Barcodes (Cat # 514106) or
- NEXTFLEX® ChIP-Seq Barcodes – 6 / 12 / 24 / 48 (Cat # 514120, 514121, 514122, 514123) or
- NEXTFLEX-96™ ChIP-Seq Barcodes (Cat # 514124)
-
Thaw NEXTFLEX® Ligase Buffer Mix 2.0 to room temperature, and vortex for 5- 10 seconds. Do not spin down tube, as this may cause components of the mix to separate and affect performance.
-
Perform adapter dilutions with Nuclease-free Water. Dilute the adapter concentration to 0.625 µM (a 1/40 dilution), and add 2.5 µL of adapter to each sample.
The following reaction must be mixed thoroughly. The NEXTFLEX® Ligase Enzyme 2.0 is very viscous. Thorough mixing of the reaction below is critical to obtaining optimal results.
Suggestion: To mix, pipette up and down 15 times; visually inspect tubes to ensure proper homogenization. Combine the following in the PCR plate and mix thoroughly by pipette:- 50 µL44.5 µL NEXTFLEX® Ligase BuffEnd Repaired & Adenylated DNA (from Step A1) er Mix 2.0*
- 2.5 µL NEXTFLEX® Barcoded Adapter
- 3.0 µL NEXTFLEX® Ligase Enzyme 2.0*
- 100 μL TOTAL
- These components can be premixed and added in a single step. Adapter should not be premixed in order to prevent excess adapter dimer formation. 3. Apply adhesive PCR plate seal and incubate in a thermal cycler with heated lid turned off or open for 15 minutes at 20°C, followed by a 4°C hold. 4. Add 65 µL of Nuclease-free water and 35 µL NEXTFLEX® Cleanup Beads 2.0 to each sample. Mix thoroughly until homogenized. The NEXTFLEX® Cleanup Beads 2.0 and Nuclease-free water can be premixed and added in a single step. 5. Incubate sample at room temperature for 5 minutes. 6. Place the 96 well PCR Plate on the magnetic stand at room temperature for 5 minutes or until supernatant appears completely clear. 7. Remove and discard clear supernatant, taking care not to disturb beads. Some liquid may remain in wells. 8. With plate on stand, add 200 µL of 80% ethanol to each magnetic bead pellet and incubate plate at room temperature for 30 seconds. Carefully remove ethanol by pipette. 9. Repeat previous step for a total of 2 ethanol washes. Ensure all ethanol has been removed. 10. Remove the 96 well PCR plate from the magnetic stand and let dry at room temperature for 3 minutes. 11. Resuspend dried beads with 25 µL of Resuspension Buffer. Mix thoroughly until homogenized. 12. Incubate sample at room temperature for 2 minutes. 13. Place the 96 well PCR Plate on the magnetic stand at room temperature for 2 minutes or until the supernatant appears completely clear. 14. Do not discard the supernatant in this step. Transfer 23 µL of clear sample to a new well. Remove the 96 well PCR plate from the magnetic stand. 15. The procedure may be safely stopped at this step with samples stored at -20°C if needed. To restart, thaw the frozen samples on ice before proceeding with Step C.
STEP C: PCR Amplification
Materials
Bioo Scientific Supplied
GREEN CAP – NEXTFLEX® PCR Master Mix 2.0, NEXTFLEX® Primer Mix 2.0
WHITE CAP – Nuclease-free Water, Resuspension Buffer, NEXTFLEX® Cleanup
Beads 2.0 (room temperature)
User Supplied
- 23 µL of Adapter Ligated DNA (from Step B)
- Thermal cycler
- Adhesive PCR Plate Seal
- 96 Well PCR Plate
- 80% Ethanol, freshly prepared (room temperature)
- Magnetic Stand
Note: The NEXTFLEX® Primer Mix that is included in the NEXTFLEX® NGS Barcodes are NOT compatible with this kit and should NOT be used in place of the Primer Mix 2.0.
- For each sample, combine the following reagents on ice in the PCR plate. Mix
- 23 μL Adapter Ligated DNA (from Step B)
- 25 μL NEXTFLEX® PCR Master Mix 2.0*
- 2 μL NEXTFLEX® Primer Mix 2.0*
- 50 μL TOTAL
-
These components can be premixed and added in a single step.
thoroughly.* 30 sec 98°C * 15 sec 98°C * 30 sec 65°C * 30 sec 72°C * 2 min 72°CRepeat for a total of 12 cycles
- Apply adhesive PCR plate seal and place in thermal cycler for the following PCR cycles:
- Add 45 µL of NEXTFLEX® Cleanup Beads 2.0 to each sample. Mix thoroughly until homogenized.
- Incubate at room temperature for 5 minutes.
- Place the 96 well PCR Plate on the magnetic stand at room temperature for 5 minutes or until the supernatant appears completely clear.
- Remove and discard clear supernatant taking care not to disturb beads. Some liquid may remain in wells.
- With plate on stand, add 200 µL of 80% ethanol to each magnetic bead pellet and incubate plate at room temperature for 30 seconds. Carefully remove ethanol by pipette.
- Repeat previous step for a total of 2 ethanol washes. Ensure all ethanol has been removed.
- Remove the 96 well PCR plate from the magnetic stand and let dry at room temperature for 3 minutes.
- Resuspend dried beads with 33 µL of Resuspension Buffer. Mix thoroughly until homogenized.
- Incubate resuspended beads at room temperature for 2 minutes.
- Place the 96 well PCR Plate on the magnetic stand at room temperature for 2 minutes or until the supernatant appears completely clear.
- Do not discard the supernatant in this step. Transfer 30 µL of clear sample to a new well. Remove the 96 well PCR plate from the magnetic stand.
- Examine library by electrophoresis to ensure proper library sizing and to verify exclusion of contaminating small and large fragments (recommended: LabChip® GXII Touch™ HT instrument (PerkinElmer®).
- qPCR is recommended to quantify DNA library templates for optimal cluster density. This can be performed using any qPCR quantification kit for Illumina® platforms and the NEXTflex® Primer Mix 2.0 as needed.
- The library is now ready for cluster generation per the standard Illumina® protocol. Proceed to cluster generation or seal with adhesive PCR Plate Seal and store at -20°C.
LIBRARY VALIDATION
Figure 2: Nucleosome Enriched Library
10ng input of cfDNA was used for the enrichment (or no enrichment) and
prepared using the rapid cell-free DNA-seq kit standard protocol
- A) No enrichment
- B) Mono-nucleosome enrichment
- C) Mono-, di-, tri-nucleosome enrichment
APPENDIX A
Oligonucleotide Sequences
| NEXTFLEX | Sequence |
|---|---|
| DNA Adapter 1 | 5’AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCT |
5’GATCGGAAGAGCACACGTCTGAACTCCAGTCAC CGATGT ATCTCGTATGCCGTCTTCTGCTTG
Primer 1| 5’AATGATACGGCGACCACCGAGATCTACAC
Primer 2| 5’CAAGCAGAAGACGGCATACGAGAT
WE WANT TO HEAR FROM YOU!
Your feedback is important to us. Tell us what you think of our kits by
scanning the QR code or visiting our website at
www.biooscientific.com/NGSfeedback.
We can’t wait to hear from you!
THE NGS EXPERTS™
- Bioo Scientific Corporation
- 7050 Burleson Road, Austin, Texas 78744
- BiooScientific.com
- P: 1.888.208.2246
- F: 512.707.8122
- Bioo Research Products Group
- nextgen@biooscientific.com
- Made in the USA
References
- Library Preparation Kits - PerkinElmer Applied Genomics
- Library Preparation Kits - PerkinElmer Applied Genomics
Read User Manual Online (PDF format)
Read User Manual Online (PDF format) >>